Sanger Sequencing

Traditional DNA sequencing. Each reaction produces a single sequence so it only works on amplified DNA of a single species. A sequence is a series of nucleotide bases represented by the letters A, T, C & G. Here is the sequence of part of the 12S gene for a minnow (Phoxinus phoxinus): CACCGCGGTTAAACGAGAGGCCCTAGTTAATAATTGACGGCGTAAAGGGTGGTTAGGGGG